King Saud University
  Help (new window)
Search


Guidelines_English_Final
تحميل الدليل التدريبي

أسئلة شائعة


 

 

Associations between the Q223R polymorphism of the leptin receptor gene and obesity in overweight and obese Saudi women

 

Maha H. Daghestani, Pinar T Ozand, Ahmed R. Al-Himadi, and Ali N. Al-Odaib

 

 

 

Introduction: Leptin, a hormone secreted by adipocytes, plays a pivotal role in the control of body weight. Rodents with mutations in the leptin receptor gene develop morbid obesity. The human leptin receptor gene contains a number of single nucleotide polymorphisms, including Q223R, which changes an amino acid on the extracellular region common to all isoforms of the receptor.  

Aims: The aim of this study was to examine  whether Q223R polymorphism in the leptin receptor (LEPR) gene were related to obesity and body fat distribution phenotypes, such as waist and hip circumferences and evaluate the associations between Q223R and certain metabolic parameters.

Material and methods: To test this possibility, 122 lean overweight and obese women, aged 19–36 yr were genotyped for the Q223R polymorphism, and their body mass index (BMI), waist-to-hip ratio (WHR), leptin, insulin, fasting glucose, high-density lipoprotein (HDL)-, low-density lipoprotein (LDL)-, and total cholesterol, and triglyceride plasma levels were measured.

Results: Here, we demonstrate that, in Saudi women, a higher percentage of homozygotes for the R223 allele was found among obese subjects vs. normal weight subjects (57.8% vs. 19.2%; P <.0001). R223R homozygote genotype and R223Q heterozygote genotype had higher frequencies among obese subjects. Furthermore, in overweight group, R223R homozygotes and R223Q hetrozygotes had higher cholesterol and insulin levels, whereas in obese subjects, BMI and leptin levels were increased significantly in R223R homozygotes and R223Q hetrozygotes.

In conclusion, these findings support the hypothesis that the Q223R of the leptin receptor gene is associated with obesity and the R223R homozygotes and R223Q hetrozygotes subjects of the LEPR gene polymorphism are more susceptible to metabolic abnormalities.

                                                                            G

                         cDNA         GTA  ATT  TTC  CAG  TCA  CCT  CTA

      Exon 6        codon          220    221    222   223     224    225    226

                         amino acid   Val    Ile      Phe   Gln     Ser     Pro     Leu

                                                                           Arg

Figure 1: The location of the polymorphism of exon 6 described in this study. Polymorphism in exon 6 is shown with the published cDNA sequence. The codon number is underneath, followed by the corresponding amino acid. The alternative nucleotide at each polymorphic site is shown above the cDNA sequence and the substituted amino acid is shown on the last line.

 

 

 

 

 

 

 

 

Wild type                                

 A.                         CTGGTGGAGTAATTTTCCAGTCACCTC                    Forward

              

     

 

                                                

Heterozygous

                                                                                                                                                                             

B.                        CTGGTGGAGTAATTTTCCNGTCACCTC                           Forward                                       

 

                            

                                                                                                                                                  

Homozygous                                                                                                                                                                                                                                                                                           C.                          CTGGTGGAGTAATTTTCCGGTCACCTC                            Forward                                                                                                                

 

                           

 

Figure 2: Sequence analysis of Exon 6. A: an individual for wild type allele. B an individual for heterozygous allele, C an individual for homozygous allele.

 

 

 

Table 1:   Exon 6 polymorphism of the human leptin receptor gene. Genotype and allele frequencies in lean, over weight and obese subjects

 

 

 

Exon 6

Control lean

Control overweight

Control obese

Frequency (%)

Frequency (%)

P value

Frequency (%)

P value

 

 

 

 

 

Genotype 1/1

43 (71.67%)

11 (64.71%)

0.3

 

6 (13.33%)

<.0001

 

 

                  1/2

11(18.33%)

2 (11.76%)

      27 (60%)

          

2/2

6 (10%)

4 (23.53%)

12 (26.67%)

 

Alleles  1  

(80.8%)

(70.6%)

0.09

(42.2%)

 

<.0001

 

             2

(19.2%)

(29.4%)

(57.8%)

 

 

 

 

 
King   Saud University. All rights reserved, 2007 | Disclaimer | CiteSeerx