King Saud University
  Help (new window)
Search


Guidelines_English_Final
تحميل الدليل التدريبي

أسئلة شائعة


 

The common pentanucleotide polymorphism of the3'-untranslated region of the leptin receptor gene is associated with serum insulin levels in Saudi Females with polycystic ovary syndrome

 

Ahmed R. Al-Himadi and Maha H. Daghestani

 

 

Introduction: The polycystic ovary syndrome (PCOS) is one of the most common abnormalities in women of reproductive age. It is often associated with obesity and insulin resistance, both of which are features that are linked to the leptin receptor (LEPR) genes.

Aims: We investigated the effects of leptin receptor gene 3'-untranslated region (3'-UTR) polymorphism on phenotype, metabolic parameters and anthropometric measurements of PCOS patients

Material and Methods: 90 young Saudi Females with PCOS and 122 healthy women (control) aged 19 to 36 years. The subjects were divided into 6 groups according to their body mass index BMI; lean (BMI 18-24), overweight (BMI 25-29) and obese (BMI ≥30).

Results: There were 17 homozygotes and 46 heterozygotes for the 3'-UTR insertion allele amongst all 212 women. The results of this study show that the allele frequencies of PCOS did not differ from those of general population, as assessed in 122 female controls. The allele frequency of the insertion allele (+) of 3'UTR was significantly higher in overweight (35.3) and obese females (32.2) compared to the frequency in lean females (15.6). The insertion allele was associated with elevated insulin level in obese groups.

Conclusion: The results obtained from this study indicated that in the obese patients with PCOS and obese control most variable values increased in ins/ins (+ +) homozygote but the significant high value recorded among BMI (45.2 ± 7.84 kg/m2, P= 0.02, 40.9 ± 7.11 kg/m2, P = 0.042 respectively). Our findings support the hypothesis that alterations in the leptin signaling system could contribute to serum insulin levels, also the obesity in Saudi Females are influenced by the leptin receptor gene 3'-UTR polymorphism.

 

This project granted by king Saud University Dean ship of scientific research  no.DSR-AR2(29).

 

 

 

 

 

 

 

            Figure 1: A PCR assay for the CTTTA insertion at the 3'UTR of the leptin receptor gene. A fragment of 114 bp or 119 bp in size was amplified, digested with the enzyme Rsal and analyzed by agarose gel electrophoresis, Lane 1: molecular size marker (a 100 bp ladder); lane 2,7and 10: undigested sample, lanes 3, 4, 5, 6 and 9: individuals with genotypes  heterozygous( del /ins, - +  ), lanes 6 and 8: individuals with genotypes homozygous ( ins/ins, +  +  ).

 

 

 

 

 

 

 

 

 

A.     ATAGATTATAGTTGTGGGTGGGAGAG                      Forward (- -)

 

B.    GTGTAATAGATTACTTTATAGTTGTG                       Forward (+ +)

                                                                                        

 

 

C.      GTGTAATAGATT                                                  Forward (- +)

 

Figure 2: Sequence analysis of 3'-untranslated region. A: an individual homozygous for the pentanucleotide deletion. B an individual homozygous for the insertion allele, C an individual for heterozygous allele.

 

 

 

Table 1: 3'UTR pentanucleotide insertion/deletion (ins/del) polymorphism of the human leptin receptor gene. Genotype and allele frequencies in the lean, overweight, obese and in the total study population

 

3'UTR

Lean

Overweight

Obese

Study population

Frequency (%)

Frequency (%)

Frequency (%)

Frequency (%)

Genotype

del/del

60(75%)

24(64.87%)

P value

65(68.42%)

P value

149(70.28%)

Genotype

del/ins

17(21.25%)

8(21.62%)

o.25

21(22.11%)

o.3

46(21.70%)

Genotype

ins/ins

3(3.75%)

5(13.51%)

9(9.47%)

17(8.02%)

Allele

del

(85.62%)

(75.68%)

0.06

(79.47%)

0.09

(81.13%)

Allele

Ins

 

(14.38%)

(24.32%)

(20.53%)

(18.87%)

 

 

 

 

Table 2: 3'UTR pentanucleotide insertion/deletion polymorphism of the human leptin receptor gene. Genotype and allele frequencies in lean, over weight and obese control subjects

 

3'UTR

control lean

control overweight

control obese

Frequency (%)

Frequency (%)

P value

Frequency (%)

P value

 

 

 

 

 

0.03

Genotype del/del

    43 (71.67%)

9 (52.94%)

0.02

23 (51.11%)

Genotype

del/ins

15 (25%)

4 (23.53%)

15 (33.33%)

Genotype

ins/ins

2 (3.33%)

4 (23.53%)

7 (15.56%)

Allele

del

(84.2%)

(64.7%)

0.01

(67.8%)

0.005

Allele

Ins

(15.8%)

(35.3%)

(32.2%)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 3: 3'UTR pentanucleotide insertion/deletion polymorphism of the human leptin receptor gene. Genotype and allele frequencies in lean, over weight and obese PCOS patients

 

3'UTR

PCOS Lean

PCOS Overweight

 PCOS obese

Frequency (%)

P value

Frequency (%)

P value

Frequency (%)

P value

 

 

 

 

 

 

Genotypes del/del

17 (85%)

0.4

15 (75%)

0.2

42 (84%)

 0.2

Genotype

del/ins

2 (10%)

4 (20%)

6 (12%)

Genotypes

ins/ins

1 (5%)

1 (5%)

2 (4%)

Allele

del

(90%)

0.4

(85%)

0.2

(90%)

0. 2

Allele

Ins

(10%)

(15%)

(10%)

 

 

 
King   Saud University. All rights reserved, 2007 | Disclaimer | CiteSeerx